View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_96 (Length: 238)
Name: NF3342_low_96
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_96 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 115 - 238
Target Start/End: Complemental strand, 38214116 - 38213993
Alignment:
| Q |
115 |
ttggttcattatgtaccacaattcatttcgacagtagtgtactctcgtaaaacactggatgtggatagttggtcgactattaagtaaaaaggttgcgtgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38214116 |
ttggttcattatgtaccacaattcatttcgacagtagtatactctcgtaaaacactggatgtggatagttggtcgactattaagtaaaaaggttgggtgt |
38214017 |
T |
|
| Q |
215 |
gtataaatgattcaattgattttt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38214016 |
gtataaatgattcaattgattttt |
38213993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 17 - 104
Target Start/End: Complemental strand, 38214262 - 38214175
Alignment:
| Q |
17 |
aaataggagacttgtaaaataaacttctactttacattagtcctctnnnnnnntattagtggtcattaagctcgttcatccctttcct |
104 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38214262 |
aaataggtgacttgtaaaataaacttctattttacattagtcctctaaaaaaatattagtggtcattaagctcgttcatccctttcct |
38214175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University