View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_97 (Length: 238)
Name: NF3342_low_97
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44494939 - 44494715
Alignment:
| Q |
1 |
caatagtttgcttgagatggattgggaggtcaagatttatc-ttttttataggaaagtgaaattttattcaggtgttagccaatatagggtgtga--cca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
44494939 |
caatagtttgcttgagatggattgggaggtcaagatttatcattttttataggaaagtgaaattttatgcaggtgttagccaatatagggtgtgagacca |
44494840 |
T |
 |
| Q |
98 |
aggttctactatggttcgtaccaccaaatctctgctc-aacttagtcttttattgttacttgttagttgataaagttggtgcgtcagctcaacattcttt |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494839 |
aggttctactatggttcgtacgaccaaatctctgctctaacttagtcttttattgttacttgttagttgataaagttggtgcgtcagctcaacattcttt |
44494740 |
T |
 |
| Q |
197 |
ctagttttttatattatgggctttc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44494739 |
ctagttttttatattatgggctttc |
44494715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University