View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_99 (Length: 237)
Name: NF3342_low_99
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 12307926 - 12308145
Alignment:
| Q |
1 |
tgcttattcaaaatttgattcatgttttatttcaagacgtatgaatctggttttatacagaataacgggtaatattaccacgattactatgatgcgacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12307926 |
tgcttattcaaaatttgattcatgttttatttcaagacgtatgaatttggttttatacagaataacgggtaatattaccacgattactacgatgcgacta |
12308025 |
T |
|
| Q |
101 |
ttatttgttactcgagtataggtttcctttaagtttgttataatatgtctannnnnnnnnnnnnataaagcaaatctcttgtagataatatatttacaga |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12308026 |
ttatatgttactcgagtataggtttcctttaagtttgttataatatgtctattttttattttttataaagcaaatctcttgtagataatatatttacaga |
12308125 |
T |
|
| Q |
201 |
tccgcaatctatattgaaca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12308126 |
tccgcaatctatattgaaca |
12308145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University