View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3347_low_9 (Length: 243)
Name: NF3347_low_9
Description: NF3347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3347_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 52396406 - 52396633
Alignment:
| Q |
19 |
aacttcttctttgatatgaattgcgtgagaagctgtagcaccttc---ttcttcttcggtaagtactgattcttttctttcggttgaaacgtcgtcgtag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396406 |
aacttcttctttgatatgaattgcgtgagaagctgtagcaccttcttcttcttcttcggttagtactgattcttttctttcggttgaaacgtcgtcgtag |
52396505 |
T |
 |
| Q |
116 |
gtgtaagagctggaatttgcactgtcattgaataactctggttttattgatgggattagacgagaattgtagccaccgatttcaccgtcgtaaccaccgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396506 |
gtgtaagagctggaatttgcactgtcattgaataactctggttttattgatgggattagacgagaattgtagccaccgatttcaccgtcgtaaccaccgt |
52396605 |
T |
 |
| Q |
216 |
gtgctaccgccattttatttctttgttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52396606 |
gtgctaccgccattttatttctttgttt |
52396633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University