View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3348_high_19 (Length: 238)
Name: NF3348_high_19
Description: NF3348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3348_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 60 - 222
Target Start/End: Original strand, 22299578 - 22299741
Alignment:
| Q |
60 |
taagtgaaagtgataattcttgcatgatgattctttttgacaataatacagcttgcaaagatttaatcacatgctcactcaacaactcctagcagtatca |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22299578 |
taagtgaaagtgataattcttgcatgatgattctttttgacaatattacagcttgcaaagatttaagcacatgctcactcaacaactcctagcagtatca |
22299677 |
T |
 |
| Q |
160 |
catgcacaagctaaaatattaccaaaatgatataaacaacaa-actcactttcttaaagaaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
22299678 |
catgcacaagctaaaatattaccaaaatgatataaacaacaatactcactttcttcaagaaaaa |
22299741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 136 - 222
Target Start/End: Original strand, 22293786 - 22293872
Alignment:
| Q |
136 |
actcaacaactcctagcagtatcacatgcacaagctaaaatattaccaaaatgatataaacaacaaactcactttcttaaagaaaaa |
222 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22293786 |
actcaacagctcccggcagtatcacatgcacaagctaaaatattaccaaaatgatacaaacaacaaactcactttcttaatgaaaaa |
22293872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University