View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3348_high_23 (Length: 226)
Name: NF3348_high_23
Description: NF3348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3348_high_23 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 40482900 - 40483119
Alignment:
| Q |
7 |
ccaacaattgtttcatttcaatgtgaatatgaccaggagttaagtccccagtgctgggtgatgatacctcaagttcactcgaattggtgaaagtctttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482900 |
ccaacaattgtttcatttcaatgtgaatatgaccaggagttaagtctccagtgctgggtgatgatacctcaagttcactcgaattggtgaaagtctttga |
40482999 |
T |
|
| Q |
107 |
tttggaaggaaatgggattccaatatctgacttgtggaaagataggaaagcagttgttgcatttgctcgtcactttgggtgattttctcttattagattc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40483000 |
tttggaaggaaatgggattccaatatctgacttgtggaaagataggaaagcagttgttgcatttgctcgtcactttgggtgattttctcttattagattc |
40483099 |
T |
|
| Q |
207 |
aaagatcaagctaccctttt |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40483100 |
aaagatcaagctaccctttt |
40483119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University