View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3348_high_5 (Length: 467)
Name: NF3348_high_5
Description: NF3348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3348_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 33 - 453
Target Start/End: Original strand, 30654909 - 30655335
Alignment:
| Q |
33 |
gttgttgttgttgcgtttgtagctgtttggttgtgctggaatggcaccgccgtggtttcacgtctccgacaatgctcaggggcttttgttggtggtagtg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30654909 |
gttgttgttgttgcgtttgtagctgtttggttgtgctggaatggcaccgccgtggtttcacgtctccgacaatgctcaggggctgttgttggtggtagtg |
30655008 |
T |
|
| Q |
133 |
ttttgtaaaagggatgggaacaggaatagaggtgctgatatacgnnnnnnnggatctgttttggtggatggtcttgggagacctatgggtgttgatgtgg |
232 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| | ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30655009 |
ttttgtaaaagggatgggaagaggaacagaggtgttaatatacgtttttttggatcttttttggtggatggtcttgggagacctatgggtgttgatgtgg |
30655108 |
T |
|
| Q |
233 |
tgttttgtatggtgttttggggttgttacggtggcttgaaagagcggtggtgaagtgttataggtgtttgcttggg------tgtggtggttgcatcttt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30655109 |
tgttttgtatggtgttttggggttgttacggtggcttgaaagagtggtggtgaagtgttataggtgtttgcttgggcgtggtagtggtggttgcatcttt |
30655208 |
T |
|
| Q |
327 |
tgggtggtattagctcttaaggggttttaaaggtggattttttgttgagttatgggtgttgatcatataggttgagggtgttgaggaaagggaggcataa |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30655209 |
tgggtggtattagctcttaaggggttttaaaggtggagtttttgctgagttatgggtgttgatcatataggttgagggtgttgaggaaagggaggcataa |
30655308 |
T |
|
| Q |
427 |
tcgtacatcaattggtattattgttat |
453 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
30655309 |
tcgtacatcaattggtgttattgttat |
30655335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 135; Significance: 4e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 20 - 308
Target Start/End: Original strand, 38928716 - 38929003
Alignment:
| Q |
20 |
ctttgcaaacaacgttgttgttgttgcgtttgtagctgtttggttgtgctggaatggcaccgccgtggtttcacgtctccgacaatgctcaggggctttt |
119 |
Q |
| |
|
||||||||||| | | ||||||||||||||||| | |||||||||||| | | |||||||||||||||||| ||| |||||||||| || | ||||||| |
|
|
| T |
38928716 |
ctttgcaaacaccttggttgttgttgcgtttgttgttgtttggttgtgtttggatggcaccgccgtggtttagcgtgtccgacaatggtctgtggctttt |
38928815 |
T |
|
| Q |
120 |
gttggtggtagtgttttgtaaaagggatgggaacaggaatagaggtgctgatatacgnnnnnnnggatctgttttggtggatggtcttgggagacctatg |
219 |
Q |
| |
|
| | | ||||||||||||||||| ||||||||| ||||| | ||||| || ||| || |||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
38928816 |
gctaggggtagtgttttgtaaaaaggatgggaagaggaacataggtgttgctattcgtttttt-ggatttgttttggtggagggtcttgggagacttatg |
38928914 |
T |
|
| Q |
220 |
ggtgttgatgtggtgttttgtatggtgttttggggttgttacggtggcttgaaagagcggtggtgaagtgttataggtgtttgcttggg |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38928915 |
ggtgttgatgtgaggttttgtacggtgttttggggttgttatggtggcttgaaagagcgatggtgaagtgttataggtgtttgcttggg |
38929003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University