View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3348_low_8 (Length: 406)
Name: NF3348_low_8
Description: NF3348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3348_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 36681140 - 36681292
Alignment:
| Q |
1 |
gggcgttgtgtgccaagcaaaggaaacagcacatagagaaaatggttaagattacgagaatatttgagggcttcatgtttattgcttactaggatagatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36681140 |
gggcgttgtgtgccaagcaaaggaaacagcacatagagaaaatggttaagattacgagaatatttgagggcttcatgtttattgcttactaggatagatc |
36681239 |
T |
 |
| Q |
101 |
gttattggatgatggattaattctaaggctaaatagttcaatttataaggtac |
153 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36681240 |
gttattggatgatggattaattcgaaggctaaatagttcaatttataaggtac |
36681292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 206 - 397
Target Start/End: Original strand, 36681345 - 36681536
Alignment:
| Q |
206 |
accaatctagtggtgtggcctcttctttctctcattctctagagtctagattcactnnnnnnngaaatcacaaaaatagagaatgcaaaatatgtgatcn |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36681345 |
accaatctagtggtgtggcctcttctttctctcattctctagagtctagattcactaaaaaaagaaatcacaaaaatagagaatgcaaagtatgtgatct |
36681444 |
T |
 |
| Q |
306 |
nnnnnnagtgagaaagattgtttcattatctaaatttgacgacaaaaatcagttgaaaattgtatgtcgcttgtaccatctttttacctttg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36681445 |
ttttttagtgagaaagattgtttcattatctaaatttgacgacaaaaatcagttgaaaattgtatgtcgctcgtaccatctttttacctttg |
36681536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University