View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3349_low_12 (Length: 234)
Name: NF3349_low_12
Description: NF3349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3349_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 58 - 221
Target Start/End: Complemental strand, 43615216 - 43615053
Alignment:
| Q |
58 |
ttgtcatttcaaattaccgataatgatccatcagtccccacacttcctacctttaagaagcattttaagattgtttagatatgatgcagagtactcggtc |
157 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43615216 |
ttgtcatttcaaattaccgataatgacccatcagtccccacacttcctacctttaagaagcattttaagattgtttagatatgatgcagagtactcagtc |
43615117 |
T |
 |
| Q |
158 |
aaattctattaagcttttgaatttgaaaacggaaggaaggaaactatcatataaaacaactttg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615116 |
aaattctattaagcttttgaatttgaaaacggaaggaaggaaactatcatataaaacaactttg |
43615053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 59 - 185
Target Start/End: Complemental strand, 43646987 - 43646861
Alignment:
| Q |
59 |
tgtcatttcaaattaccgataatgatccatcagtccccacacttcctacctttaagaagcattttaagattgtttagatatgatgcagagtactcggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| || |||||||| ||| || |||| | ||||||||||||||||| ||||| |||| ||| ||||||| |
|
|
| T |
43646987 |
tgtcatttcaaattacccataatgacccatcattcaccacactttctatctataaggaacattttaagattgtttatatatggtgcaaagttttcggtca |
43646888 |
T |
 |
| Q |
159 |
aattctattaagcttttgaatttgaaa |
185 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
43646887 |
gattctattaagtttttgaatttgaaa |
43646861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University