View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3349_low_5 (Length: 382)
Name: NF3349_low_5
Description: NF3349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3349_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 17 - 268
Target Start/End: Original strand, 47365485 - 47365736
Alignment:
| Q |
17 |
agctgcaagttaaagattgaagaatcttcagctatcaaaattcaaacaacatttagaggctacatagtgagttttgtattcactttcacctttcatttgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47365485 |
agctgcaagttaaagattgaagaatcttcagctatcaaaattcaaacaacatttagaggctacatagtgagttttgtattcacttttacctttcatttgt |
47365584 |
T |
|
| Q |
117 |
atcaacttaaacccttttttcatagttttccccttctgctaaatgctcaattatttttgtgacaaacatagtacaattaaggacagacaaactgaaggtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365585 |
atcaacttaaacccttttttcatagttttccccttctgctaaatgctcaattatttttgtgacaaacatagtacaattaaggacagacaaactgaaggtg |
47365684 |
T |
|
| Q |
217 |
aacttaggaacagatactagaattttatatgcaaatttcacatatttaatac |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365685 |
aacttaggaacagatactagaattttatatgcaaatttcacatatttaatac |
47365736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 325 - 371
Target Start/End: Original strand, 47365793 - 47365839
Alignment:
| Q |
325 |
ctttagtggattagattgacaaactgaagtcaccttactatattctt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365793 |
ctttagtggattagattgacaaactgaagtcaccttactatattctt |
47365839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University