View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_high_18 (Length: 253)
Name: NF3350_high_18
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 124 - 241
Target Start/End: Original strand, 2180935 - 2181052
Alignment:
| Q |
124 |
ctgtttatgttggcttactttttgtttgtcacttacatatagtgcagaagtggcattggaagctgcaaatgctgcaatagcaggtggcatttcagttgta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2180935 |
ctgtttatgttggcttactttttgtttgtcacttacatatagtgcagaagtggcattggaagctgcaaatgctgcaatagcaggtggcatttcagttgta |
2181034 |
T |
 |
| Q |
224 |
agtttacttttcatgttc |
241 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2181035 |
agtttacttttcatgttc |
2181052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 17 - 126
Target Start/End: Original strand, 2180754 - 2180864
Alignment:
| Q |
17 |
gtttgtccattccctttctgctgaacttggacannnnnnn-catgttataaggagttaaaggaactggattcgaactctggtgacggagaaattattaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
2180754 |
gtttgtccattccctttctgctgaacttggacattctttttcatgttataaggagttaaaggaactgggttcggactctggtgacggagaaattattaac |
2180853 |
T |
 |
| Q |
116 |
aataacaactg |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
2180854 |
aataacaactg |
2180864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University