View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_high_19 (Length: 246)
Name: NF3350_high_19
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 417830 - 417614
Alignment:
| Q |
14 |
agaccagtcatgtggataattaaaacttgagagcaaaatactgttacaaaagagaatggaaagtattgtttgcagtcagcttgtccatttgcaagctgta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417830 |
agaccagtcatgtggataattaaaacttgagagaaaaatactgttacaaaagagaatggaaagtattgtttgcagtcagcttgtccatttgcaagctgta |
417731 |
T |
 |
| Q |
114 |
cgattcaacagtgcaacatcttcatggataaatagtttcaccattttaagaccacagtggtacattgtttaacattggagtgatgtggcaacctactgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417730 |
cgattcaacagtgcaacatcttcatggataaatagtttcaccattttaagaccacagtggtacattgtttaacattggagtgatgtggcaacctactgaa |
417631 |
T |
 |
| Q |
214 |
gacatggctattgaatc |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
417630 |
gacatggctattgaatc |
417614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University