View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3350_high_22 (Length: 238)

Name: NF3350_high_22
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3350_high_22
NF3350_high_22
[»] chr8 (1 HSPs)
chr8 (18-50)||(34268050-34268082)


Alignment Details
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 34268050 - 34268082
Alignment:
18 agaataagggatgactcgtctacatacaattac 50  Q
    |||||||||||||||||||||||||||||||||    
34268050 agaataagggatgactcgtctacatacaattac 34268082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University