View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_low_16 (Length: 323)
Name: NF3350_low_16
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 59 - 307
Target Start/End: Complemental strand, 42043124 - 42042876
Alignment:
| Q |
59 |
agcaaagtaattgctacaaacctgtttgaacttg---tgaaacaagatatataactatacgaaacttctatgatattcatcaaattcataggatatatag |
155 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42043124 |
agcaaagtaattgctacgaacctgcttgaacttgaagtgcaacaagatatataactatactaaacttctatgatattcatcaaattcataggatatatag |
42043025 |
T |
 |
| Q |
156 |
gtgtgtaactatataatttgacagcagagttaagggaagatgtagtatcatattatcaatatatcattggaatttactatttagctatcttgacatgact |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42043024 |
gtgtgtaactatataatttgacagcagagttaagggaagatgtagtatcatattatcaatatatcattggaatttactatttagctatcttgac---act |
42042928 |
T |
 |
| Q |
256 |
acaaaattcaaaaatgttttattttcataataaactaataccttaacaaaga |
307 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42042927 |
acaaaattcaaaaatgttttatttttataataaactaataccttaacaaaga |
42042876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University