View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_low_2 (Length: 516)
Name: NF3350_low_2
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-141
Query Start/End: Original strand, 194 - 504
Target Start/End: Original strand, 13974012 - 13974337
Alignment:
| Q |
194 |
atgaaatggcttaaaattgcgaatcattgttaagttgcctatttttgaagcacttc---tttcttttttcagttaaactgcaagcatcacgccgcaggtc |
290 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974012 |
atgaaatggattaaaattgcgaatcattgttaagttgcctatttttgaagcacttcttctttcttttttcagttaaactgcaagcatcacgccgcaggtc |
13974111 |
T |
 |
| Q |
291 |
tctctttactctagcaacatccatgattgtcttcacatccaaggcctacaacatcctctctctcatttccatcgctaaaatggcattgacagataaaacc |
390 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974112 |
tctctttacactagcaacatccatgattgtcttcacatccaaggcctacaacatcctctctctcatttccatcgctaaaatggcattgacagataaaacc |
13974211 |
T |
 |
| Q |
391 |
gtatg------------tgtacaatgttttgcatttaatttttcgaattttccttctttccccctcttatagtggaattttatataataaaatcattcac |
478 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13974212 |
gtatgtgcatcttgtcttgtacaatgttttgcatttaatttttcgaattttccttctttcccccttttatagtggtattttatataataaaatcattcac |
13974311 |
T |
 |
| Q |
479 |
ttgtatctcatagttttttatgcttc |
504 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
13974312 |
ttgtatctcatagttttttatgcttc |
13974337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University