View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_low_20 (Length: 270)
Name: NF3350_low_20
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 3760534 - 3760653
Alignment:
| Q |
1 |
aagaagagtaaatggggtactttgattgttatgatcaaaagaaagtgttgttgggatacgttaattttctcgatcatgataaagcattccaatggaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760534 |
aagaagagtaaatggggtactttgattgttatgatcaaaagaaagtgttgttgggatacgttaattttctcgatcatgataaagcattccaatggaaact |
3760633 |
T |
 |
| Q |
101 |
tactgacaagaataggtttg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3760634 |
tactgacaagaataggtttg |
3760653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 3760685 - 3760786
Alignment:
| Q |
152 |
gagagattcgagatggcaa-tcacaagcaaactgagtgagaagggtttgatgctgatggtaaaggcaaaggcagatcttcatccatgggaaaatgagaat |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760685 |
gagagattcgagatggcaaatcacaagcaaactgagtgagaagggtttgatgctgatggtaaaggcaaaggcagatcttcatccatgggaaaatgagaat |
3760784 |
T |
 |
| Q |
251 |
ag |
252 |
Q |
| |
|
|| |
|
|
| T |
3760785 |
ag |
3760786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University