View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_low_23 (Length: 244)
Name: NF3350_low_23
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 23 - 228
Target Start/End: Complemental strand, 28265818 - 28265613
Alignment:
| Q |
23 |
gttcgctgatctttcgcgttgtgaattggaaaaaagaagtatcagcaaatttcaagctggaacatgaatttagaagattataactcgtgaaaatgaagat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265818 |
gttcgctgatctttcgcgttgtgaattggaaaaaagaagtatcagcaaatttcaagctggaacatgaatttagaagattataactcgtgaaaatgaagat |
28265719 |
T |
|
| Q |
123 |
atcttcactaaagagatcaataattatccaatacaactaaattcatagcagctaacacaatctggaagaaaaatgtgagataaattgcgaatttgacata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265718 |
atcttcactaaagagatcaataattatccaatacaactaaattcatagcagctaacacaatctggaagaaaaatgtgagataaattgcgaatttgacata |
28265619 |
T |
|
| Q |
223 |
aatgtt |
228 |
Q |
| |
|
|||||| |
|
|
| T |
28265618 |
aatgtt |
28265613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University