View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_low_28 (Length: 237)
Name: NF3350_low_28
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 33751069 - 33750934
Alignment:
| Q |
1 |
ttatagtccggattcaaactcgggttctaccaaacaatttgtccttaactcaagctcattaaaatgaatcttaatggtaacaacacctccactgagaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751069 |
ttatagtccggattcaaactcgggttctaccaaacaatttgtccttaactcaagctcattaaaatgaatcttaatggtaacaacacctccactgagaaac |
33750970 |
T |
|
| Q |
101 |
aaaatcacccttaaaacttcagaagattttgatgct |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750969 |
aaaatcacccttaaaacttcagaagattttgatgct |
33750934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University