View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3350_low_30 (Length: 228)
Name: NF3350_low_30
Description: NF3350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3350_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 45981999 - 45981811
Alignment:
| Q |
19 |
gatgatccaccaactggtaaaatcactttcaaaacaccttctggactttttagaagtttccctgtttctgcttttgaaattgaagaagagaaatcaagtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45981999 |
gatgatccaccaactggtaaaatcactttcaaaacaccttctggactttttagaagtttccctgtttctgcttttgaaattgaagaagagaaatcaagtg |
45981900 |
T |
|
| Q |
119 |
gtgttgctgttaaggaagttgctgctaacaaggtcaatgaaactgttgctgctgctgctggtgtcaaagaggtctaagtctattgattt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45981899 |
gtgttgctgttaaggaagttgctgctaacaaggtcaatgaaactgttgctgctgctgctggtgtcaaagaggtctaagtctattgattt |
45981811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 41716584 - 41716496
Alignment:
| Q |
19 |
gatgatccaccaactggtaaaatcactttcaaaacaccttctggactttttagaagtttccctgtttctgcttttgaaattgaagaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||| ||||| ||| || ||||||||||||||| |||| ||||| |
|
|
| T |
41716584 |
gatgatccaccaactggtaaaatcactttcaaagctacttctggactttctagaacttttccagtttctgcttttgaagttgaggaaga |
41716496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 37614673 - 37614761
Alignment:
| Q |
19 |
gatgatccaccaactggtaaaatcactttcaaaacaccttctggactttttagaagtttccctgtttctgcttttgaaattgaagaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | |||||||||| |||| |||||||| || |||||||| || |||||||| |
|
|
| T |
37614673 |
gatgatccaccaactggtaaaatcactttcagggccattactggacttttcagaactttccctgcctcagcttttgagatagaagaaga |
37614761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University