View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3351_high_24 (Length: 284)
Name: NF3351_high_24
Description: NF3351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3351_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 167 - 275
Target Start/End: Original strand, 7383504 - 7383613
Alignment:
| Q |
167 |
ttactattattgctctttccacacat-aagcattgtaaaggaacttaatatactgaaaaattctaaaagtagtggtgttgactgttaagttagtggagtt |
265 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7383504 |
ttactattattgctcgttccacacattaagcattgtaaaggaacttaatatactaaaaaattctaaaagtagtggtgttgactgttaagttagtggagtt |
7383603 |
T |
|
| Q |
266 |
gtggtctgtg |
275 |
Q |
| |
|
|||||||||| |
|
|
| T |
7383604 |
gtggtctgtg |
7383613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University