View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3351_high_35 (Length: 234)
Name: NF3351_high_35
Description: NF3351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3351_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 39454465 - 39454259
Alignment:
| Q |
17 |
agaaaataaatacttgcagttggaggatagagccgaagtgtttcattaatgatcatactgacctgttcaaatatgcaaaccaaaaacaattactaggcca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39454465 |
agaaaataaatacttgcagttggaggatagagccgaagtgtttcattaatgatcatactgacctgttcaaatatgcaaaccaaaaacaattactaggcca |
39454366 |
T |
 |
| Q |
117 |
attaactcgatcaattgttttgttcgtttattgatgcacagcatatttcatacatactgcactattttttaatctaacaaatcaaatttttatgataatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39454365 |
attaactcgatcaattgttttgttcgtttattgatgcacagcatatttcatacatactgcactattttttaatctaacaaatcaaatttttatgataatt |
39454266 |
T |
 |
| Q |
217 |
catctca |
223 |
Q |
| |
|
||||||| |
|
|
| T |
39454265 |
catctca |
39454259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 39449095 - 39449153
Alignment:
| Q |
38 |
ggaggatagagccgaagtgtttcattaatgatcatactgacctgttcaaatatgcaaac |
96 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||||| |||||||||| |||||| |||| |
|
|
| T |
39449095 |
ggaggatagagtcgaagggtttcattaattatcatgctgacctgttggaatatgtaaac |
39449153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University