View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3351_low_20 (Length: 349)
Name: NF3351_low_20
Description: NF3351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3351_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 8 - 332
Target Start/End: Original strand, 43015449 - 43015776
Alignment:
| Q |
8 |
agagatgaaatgtctgctgtt---ggtgtccctagtcctttaacaagcttcacaaatgctttggatattcaacaccttaaatctgatcattttggcttca |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015449 |
agagatgaaatgtctgctgttgttggtgtccctagtcctttaacaagcttcacaaatgctttggatattcaacaccttaaatctgatcattttggcttca |
43015548 |
T |
|
| Q |
105 |
tcccatttcgaaaaagctatgatgaagtaagttacatatattatacagtaagacacttatgattgaagatatgtctagtgtttgacacatgttcatgtct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015549 |
tcccatttcgaaaaagctatgatgaagtaagttacatatattatacagtaagacacttctgattgaagatatgtctagtgtttgacacatgttcatgtct |
43015648 |
T |
|
| Q |
205 |
gacaccgacatatatagttacattcaaccactttcattttttcaaattacggcttgcatcaatgtcttacttttgtgtccggaatatgtgcaagtttttc |
304 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43015649 |
gacaccgacatatatagttacaatcaaccatttttattttttcaaattacggcttgcatcaatgtcttacttttgtgtccggaatatgtgcaagtgtttc |
43015748 |
T |
|
| Q |
305 |
atataaatcatggttcattaaacccact |
332 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
43015749 |
atataaatcatcgttcattaaacccact |
43015776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University