View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3351_low_31 (Length: 250)
Name: NF3351_low_31
Description: NF3351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3351_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 8807889 - 8807743
Alignment:
| Q |
1 |
taagattcacttgccattattatgcaataaaagggagtgtcatgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807889 |
taagattcacttgccattattatgcaataaaagggagtgtcatgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgt |
8807790 |
T |
|
| Q |
101 |
cactgccactgctactagcaatgtttaatgttgttgtcctcatgaaa |
147 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807789 |
ccctgccactgctactagcaatgtttaatgttgttgtcctcatgaaa |
8807743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 8807689 - 8807646
Alignment:
| Q |
201 |
cctccaacaagtgcaaacaaaactagttgaaccacctatgcttc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8807689 |
cctccaacaagtgcaaacaaaactagttgaaccacctttgcttc |
8807646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University