View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3351_low_8 (Length: 423)
Name: NF3351_low_8
Description: NF3351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3351_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 18 - 410
Target Start/End: Complemental strand, 36919031 - 36918639
Alignment:
| Q |
18 |
tcttcagcttctgactgaaattgagatggaagctaaagagattggaaagattttccagtctcacacaatacttgcgggttccaatactctaaagacaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919031 |
tcttcagcttctgactgaaattgagatggaagctaaagagattggaaagattttccagtctcacacaatacttgcgggttccaatactctaaagacaact |
36918932 |
T |
|
| Q |
118 |
aagagtttgcttggttgtttgaatgtaggcaagaggcgtctatgtagcatactgcaggataatcctcatgaaatgaagaactgggttcttggaataagag |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36918931 |
aagagtttgcttggttgcttgaatgtaggcaagaggcgtctatgtagcatactgcaggataatcctcatgaaatgaagaactgggttcttggaataagag |
36918832 |
T |
|
| Q |
218 |
ttaagcctatggttggcttaagggatctggaagaggagaaatcgagggtggggaagacagagttcttgttgcgcttaggttatgtggaaaacacgaaaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36918831 |
ttaagcctatggttggcttaagggatctggaagaggagaaatcgagggtggggaagacagagttcttgttgcgcttaggttatgtggaaaacacgaaaga |
36918732 |
T |
|
| Q |
318 |
aatggattcggcgtttaaggcgttcagaggtaagggagctgagcttcaggagagatttgattttattgttaatgctggattgacacgtgatga |
410 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36918731 |
aatggattcggcgtttaaggcattcagaggtaagggagctgagcttcaggagagatttgattttattgttaatgctggattgacacgtgatga |
36918639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University