View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352R-Insertion-10 (Length: 175)
Name: NF3352R-Insertion-10
Description: NF3352R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352R-Insertion-10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 8 - 175
Target Start/End: Complemental strand, 3982404 - 3982237
Alignment:
| Q |
8 |
agattatgattccattattgcatgaaaactaattgaactgagtattgaagattgaaacctctttagctctgttttcaatgatgctgacaaggaagcttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982404 |
agattatgattccattattgcatgaaaactaattgaactgagtattgaagattgaaacctccttagctctgttttcaatgatgctgacaaggaagcttga |
3982305 |
T |
 |
| Q |
108 |
accttctccaccgtcgtcttccattgttgtgtgctttcaattttcaccacattttgattttcgcgcca |
175 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982304 |
accttctccaccgtcgttttccattgttgtgtgctttcaattttcaccacattttgattttcgcgcca |
3982237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University