View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352R-Insertion-8 (Length: 210)
Name: NF3352R-Insertion-8
Description: NF3352R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352R-Insertion-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 2064923 - 2064722
Alignment:
| Q |
9 |
gtaatccatctccaacaaccaccgaacctcctcctcacactcacagccgtcgtatctctccagaaacaacacctccctccgtcatcgactcactccctct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064923 |
gtaatccatctccaacaaccaccgaacctcctcctcacactcacagccgtcgtatctctccagaaacaacacctccctccgtcatcgactcactccctct |
2064824 |
T |
|
| Q |
109 |
cttcacattctcatccatctcccgtcgttcctccgccgtcaccgccgctgattgcgctgtctgtttatcgaagttccgtaactccgacctcctccgttct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2064823 |
cttcacattctcatccatctcccgtcgttcctccgccgtcaccgccgctgactgcgctgtctgtttatcaaagttccgtaactccgacctcctccgttct |
2064724 |
T |
|
| Q |
209 |
ct |
210 |
Q |
| |
|
|| |
|
|
| T |
2064723 |
ct |
2064722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University