View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_high_22 (Length: 347)
Name: NF3352_high_22
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 6130694 - 6131013
Alignment:
| Q |
18 |
acattcagaggtaaatcacaaaatttgtgaaggttaatttgaggagtaattgataaatcactttgaatacgcaaccactaaaggataaatcaccatactc |
117 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6130694 |
acattcagaggtaaaccacgaaatttgtgaaggttaatttgaggagtaattgataaatcactttgaatacgcaaccactaaagaataaatcaccatactc |
6130793 |
T |
 |
| Q |
118 |
gaccaaacatgggaaactaaaaaagaaggtgatttaagctttcatttgtatgccatccaccaacgaaaacaagaagcttggaaacaaaaccaccatactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6130794 |
gaccaaacatgggaaactaaaaaagaaggtgatttaagctttcatttgtatgccatccaccaacgaaaacaagaagcttggaaacaaaaccaccatac-t |
6130892 |
T |
 |
| Q |
218 |
ttaacatactgtctttcgttagaggtcgattttgcaacaacttccaagcaaagacaaaaactttaaatggcaccaatttgttccacaaaatgtctttgtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130893 |
ttaacatactgtctttcgttagaggtcgattttgcaacaacttccaagcaaagacaaaaactttaaatggcaccaatttgttccacaaaatgtctttgtt |
6130992 |
T |
 |
| Q |
318 |
actaataagatcaatctctgc |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6130993 |
actaataagatcaatctctgc |
6131013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University