View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_high_32 (Length: 266)
Name: NF3352_high_32
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_high_32 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 43462219 - 43462484
Alignment:
| Q |
1 |
ttcttagaaaaacaaccaccgagtgaacatgggaaacaactgagttggactcagaaatacctcagatgaaattttttcaacatcgtgttgctgctcatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43462219 |
ttcttagaaaaacaaccaccgagtgaacatgggaaacaactgtgttggactcagaaatacctccgatgaaattttttcaacatcgtgttgctgctcatgg |
43462318 |
T |
|
| Q |
101 |
tcatatccaatctaccaaacacaaatttcagtttcaccaaacataaacgcttcacagacggttcaacaaagtccaccgcatgtcgacagcaaagatttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43462319 |
tcatatccaatctaccaaacacaaatttcagtttcaccaaacataaacgcttcacagacggttcaacaaagtccaccgcatgtcgacatcaaagatttga |
43462418 |
T |
|
| Q |
201 |
agtcaattgaatctagggtaacagcaaaaagtgcaggtcttcgagaagaatcaattttgttgtcaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43462419 |
agtcaattgaatctagggtaacagcaaaaagtgcaggtcttcgagaagaatcaattttgttgtcaa |
43462484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 156
Target Start/End: Original strand, 43452748 - 43452809
Alignment:
| Q |
95 |
tcatggtcatatccaatctaccaaacacaaatttcagtttcaccaaacataaacgcttcaca |
156 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||| ||| ||||||| |
|
|
| T |
43452748 |
tcatggtcatatccaatcaaccaaacacaaatttcagtttcacaaaacacaaattcttcaca |
43452809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 262
Target Start/End: Original strand, 43452994 - 43453041
Alignment:
| Q |
215 |
agggtaacagcaaaaagtgcaggtcttcgagaagaatcaattttgttg |
262 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
43452994 |
agggtaacaccaaaaagtgcaggtcttcgagcagaatcggttttgttg |
43453041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University