View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_high_33 (Length: 264)
Name: NF3352_high_33
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 4071956 - 4072196
Alignment:
| Q |
8 |
cgaagaatatggaacagaattggttcttttcattattactattattttgaaatttttgttacaatagtatatgagtattttgatgttgaaaaatggaaaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4071956 |
cgaaaaatatggaacagaattggttcttttcattattactattattttgaaatttttgttacaatagtatatgagtattttgatgttgaaaaatggaaaa |
4072055 |
T |
 |
| Q |
108 |
tgatgtgtaatgagattcaacaccaactcttgagctcccacatttggtttaaaaagagcatcaaaatgttgttttgccacatcacaaactccaccttaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4072056 |
tgatgtgtaatgagattcaacaccaactcttgagctcccacatttggtttaaaaagagcatcaaaatgttgttttgccacatcacaaactccaccttgac |
4072155 |
T |
 |
| Q |
208 |
atgtaatttcttcacacccctttcattcaagaggttatatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4072156 |
atgtaatttcttcacacccctttcattcaagaggttatatt |
4072196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University