View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_high_46 (Length: 223)
Name: NF3352_high_46
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 28654744 - 28654935
Alignment:
| Q |
11 |
ggagcagagatcggtaagaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgt |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28654744 |
ggagcagacatcggtaagaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgt |
28654843 |
T |
|
| Q |
111 |
gctgatattgtcgctctttctgctagagacgccattgcaatggtatgtctatg---tcatcatatacacttgttagaagttgcctctcggac |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
28654844 |
gctgatattgttgctctttctgctagagacggtattgcaatggtatgtctatgtcatcatcatatacacatgttaggagttgcctctcggac |
28654935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 11 - 176
Target Start/End: Original strand, 28635463 - 28635628
Alignment:
| Q |
11 |
ggagcagagatcggtaagaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgt |
110 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28635463 |
ggagcagacatcggtgagaagttttgggatgagaaatttcaagtatgtgaataccatcaaagcagctgtcgagaaagaatgtcccttgacagtgtcatgc |
28635562 |
T |
|
| Q |
111 |
gctgatattgtcgctctttctgctagagacgccattgcaatggtatgtctatgtcatcatatacac |
176 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28635563 |
gctgacattgtcgctctatctgctagagacggtattgcaatggtatgtctatgtcatcatatacac |
28635628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 27 - 158
Target Start/End: Original strand, 28605311 - 28605442
Alignment:
| Q |
27 |
agaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgtgctgatattgtcgctc |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| ||||||||||| |||||||||||||| ||||| ||||| |||| |
|
|
| T |
28605311 |
agaagttttgggatgagaaacttcaagtatgtgagcaccatcaaagctgctcttgaaaaagaatgtcctttgacagtgtcatgcgctgacattgttgctc |
28605410 |
T |
|
| Q |
127 |
tttctgctagagacgccattgcaatggtatgt |
158 |
Q |
| |
|
||||||||||||||| ||||| | ||||||| |
|
|
| T |
28605411 |
tttctgctagagacggtattgccagggtatgt |
28605442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 27 - 158
Target Start/End: Original strand, 28663162 - 28663293
Alignment:
| Q |
27 |
agaagttttgggatgagaaatttcaagtatgtgaacaccatcaaagctgctgttgagaaagaatgtcccttgacagtgtcatgtgctgatattgtcgctc |
126 |
Q |
| |
|
||||||| |||||| |||| ||||||||||| || ||||||||||||||||| ||||||||||||||||||||||| |||||||| || ||||| |||| |
|
|
| T |
28663162 |
agaagttccgggatgcgaaacttcaagtatgtaaaaaccatcaaagctgctgtggagaaagaatgtcccttgacagtatcatgtgccgacattgttgctc |
28663261 |
T |
|
| Q |
127 |
tttctgctagagacgccattgcaatggtatgt |
158 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||| |
|
|
| T |
28663262 |
tttccgctagagacggaattgccatggtatgt |
28663293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University