View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_high_49 (Length: 212)
Name: NF3352_high_49
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 1734280 - 1734109
Alignment:
| Q |
17 |
atatttagaaaa-tggaggttggacaatatatatagt-aggggacccataaatctaatgtggttttaggttaagctataatggatgagcttacataaaca |
114 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734280 |
atatttaaaaaagtggaggttggacaatatatatagtgaggggacccataaatttaatgtggttttaggttaagctataatggatgagcttacataaaca |
1734181 |
T |
 |
| Q |
115 |
tattttactttcatatatttgagttattagtcaatatcttagcataagacaaatatgtttatgctaattatc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734180 |
tattttactttcatatatttgagttattagtcaatatcttagcataagacaaatatgtttatgctaattatc |
1734109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University