View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_low_36 (Length: 258)
Name: NF3352_low_36
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 105 - 256
Target Start/End: Original strand, 41456662 - 41456813
Alignment:
| Q |
105 |
gtgagtacctaaatgtttttcatctaaggttgtgttcgattaagtatttgtcatatgtttttgccttgttatatttggtctataaattcgagctttgtct |
204 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41456662 |
gtgagtacccaaatatttttcatctaaggttgtgttcgattaagtatttctcatatgtttttccctcgttatatttggtctataaattcgagctttgtct |
41456761 |
T |
|
| Q |
205 |
ataaatgcccttgtaaatatcattttcaacaaacaataaaattgtcatcttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41456762 |
ataaatgcccttgtaaatatcattttcaacaaacaataaaattgtcatcttt |
41456813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 41456575 - 41456630
Alignment:
| Q |
18 |
taactagtgttctcaaacacttgtcattgtataaaacttcctatcatttaacatca |
73 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41456575 |
taactagtgtgctcaaacacttgtcatcgtataaaacttcctatcatttaacatca |
41456630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University