View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3352_low_40 (Length: 247)
Name: NF3352_low_40
Description: NF3352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3352_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 16401865 - 16401634
Alignment:
| Q |
1 |
agccataacattatccaaaatggaccgaccaataacaaatgtaattggttatttaaaatacatttatccaatacatcttttaactgatttgcttaaacag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16401865 |
agccataacattatctaaaatggaccgaccaataacaaatgtaattggttatttgaaatacatttattcaatacatcttttaactgatttgcttaaacag |
16401766 |
T |
 |
| Q |
101 |
ttaaactttatcacagctttgtacaccacattacataaggttatgagttgtcgatccttcatagaactttgtacaccacattaccaaaaataatttttct |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16401765 |
ttaaactttatcacagctttttacaccacattacataaggttatgggttgtcgatccttcatagaactttgtacaccacattaccaaaaataatttttct |
16401666 |
T |
 |
| Q |
201 |
tatgtcccatagacttaactagcgttaatttt |
232 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
16401665 |
tatgtctcatagacttaactagcgttaatttt |
16401634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University