View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3354_low_12 (Length: 261)
Name: NF3354_low_12
Description: NF3354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3354_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 4092345 - 4092104
Alignment:
| Q |
1 |
tgactttaatgggaggattagtgggttatctctattggccattttggaagttatggaaagttccaggcccaccatctctgcctcttgtaggacaccttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092345 |
tgactttaatgggaggattagtgggttatctctattggccattttggaagttaaggaaagttccaggcccaccatctctgcctcttgtaggacaccttcc |
4092246 |
T |
|
| Q |
101 |
attgctagcaaagtatggtcctgacgttttctcagtccttgctaagcaatatggccctatctacaggtttctatattctacttgcatacatatatacaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4092245 |
attgctagcaaagtatggtcctgacgttttctcagtccttgctaagcaatatggccctatctacaggtttctatattctacttgcatac----atacaat |
4092150 |
T |
|
| Q |
201 |
ttatcactttatttatctttcttcctctttttcttttagttctctg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092149 |
ttatcactttatttatctttcttcctctttttcttttagttctctg |
4092104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 55 - 170
Target Start/End: Original strand, 48175545 - 48175660
Alignment:
| Q |
55 |
ggaaagttccaggcccaccatctctgcctcttgtaggacaccttccattgctagcaaagtatggtcctgacgttttctcagtccttgctaagcaatatgg |
154 |
Q |
| |
|
|||| ||||| || |||||||||||||| | ||||| ||||||| ||||| || || |||| ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
48175545 |
ggaaggttcctggtccaccatctctgccgttggtagggcaccttcacttgctggctaaacatggccctgatgttttctcagtccttgccaagcaatatgg |
48175644 |
T |
|
| Q |
155 |
ccctatctacaggttt |
170 |
Q |
| |
|
|| || ||||||||| |
|
|
| T |
48175645 |
tccaatttacaggttt |
48175660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University