View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3355_high_1 (Length: 481)
Name: NF3355_high_1
Description: NF3355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3355_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 108 - 468
Target Start/End: Original strand, 6995478 - 6995838
Alignment:
| Q |
108 |
gaaccgggtttaatttagataacggttcaagggttcagaccttatcttgttcagcaagtgcaagcttatcggcggcttcagaaagcgcagcgtggagagg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6995478 |
gaaccgggtttaatttagataacggttcaagggttcagaccttatcttgttcagcaagtgcaagcttatcggcggcttcagaaagagcagcgtggagagg |
6995577 |
T |
 |
| Q |
208 |
ctctccctgagcttccagctccgcgatgagctcgtctttcttgacgagctcatcacgtagagcagaaacttctgattggagcgtgttgacacgtgttgaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995578 |
ctctccctgagcttccagctccgcgatgagctcgtctttcttgacgagctcatcacgtagagcagaaacttctgattggagcgtgttgacacgtgttgaa |
6995677 |
T |
 |
| Q |
308 |
agggcaatggaggtgattttgcgagccacatcgagttgctcgaaaggatcggatggtagaacttgcagcaactcctcaggaatatcgaggttcgaaccac |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995678 |
agggcaatggaggtgattttgcgagccacatcgagttgctcgaaaggatcggatggtagaacttgcagcaactcctcaggaatatcgaggttcgaaccac |
6995777 |
T |
 |
| Q |
408 |
tcaattccgccaccaacatgttcttctctcttttttctactttcttttaattgaagttatt |
468 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6995778 |
tcaattccgccaccaacatgttcttctctcttttttctactttcttttaattgtagttatt |
6995838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 293 - 374
Target Start/End: Complemental strand, 49085276 - 49085195
Alignment:
| Q |
293 |
ttgacacgtgttgaaagggcaatggaggtgattttgcgagccacatcgagttgctcgaaaggatcggatggtagaacttgca |
374 |
Q |
| |
|
||||||||||| || || |||||||| ||||| ||||| || ||||||||||| || || ||||| || ||||| ||||||| |
|
|
| T |
49085276 |
ttgacacgtgtcgatagagcaatggatgtgatcttgcgcgctacatcgagttgttcaaatggatctgacggtagtacttgca |
49085195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University