View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3355_high_11 (Length: 246)
Name: NF3355_high_11
Description: NF3355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3355_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 78 - 190
Target Start/End: Original strand, 56377056 - 56377168
Alignment:
| Q |
78 |
ccaggcatcttttgtcctcaccactatctgnnnnnnnnnnnntgctcctctctttctatatggcgtaaactcgatggctgatagtgcaagcaaagcaaac |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56377056 |
ccaggcatcttttgtcctcaccactatctgacacacacacactgctcctctctttctatatggcgtaaactcgatggctgatagtgcaagcaaagcaaac |
56377155 |
T |
 |
| Q |
178 |
caaagcaacttac |
190 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56377156 |
caaagcaacttac |
56377168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University