View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3355_low_11 (Length: 250)

Name: NF3355_low_11
Description: NF3355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3355_low_11
NF3355_low_11
[»] scaffold0140 (1 HSPs)
scaffold0140 (40-233)||(34769-34962)


Alignment Details
Target: scaffold0140 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 40 - 233
Target Start/End: Original strand, 34769 - 34962
Alignment:
40 tttggattgaaggccagtttttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggacg 139  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
34769 tttggattgaaggcgagtgtttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggagg 34868  T
140 agttagttcctttcaagtactttggtctctcgataaaggtgaatccatggggtatttatacaagggaattaggattagaacaacttcgtctgag 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
34869 agttagttcctttcaagtactttggtctctcgataaaggtgaatccatggggtatttatacaagggaactaggattagaacaactttgtctgag 34962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University