View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3355_low_11 (Length: 250)
Name: NF3355_low_11
Description: NF3355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3355_low_11 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 40 - 233
Target Start/End: Original strand, 34769 - 34962
Alignment:
| Q |
40 |
tttggattgaaggccagtttttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggacg |
139 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34769 |
tttggattgaaggcgagtgtttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggagg |
34868 |
T |
 |
| Q |
140 |
agttagttcctttcaagtactttggtctctcgataaaggtgaatccatggggtatttatacaagggaattaggattagaacaacttcgtctgag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
34869 |
agttagttcctttcaagtactttggtctctcgataaaggtgaatccatggggtatttatacaagggaactaggattagaacaactttgtctgag |
34962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University