View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3355_low_15 (Length: 229)
Name: NF3355_low_15
Description: NF3355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3355_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 2355282 - 2355478
Alignment:
| Q |
20 |
attgatgtaacaactttaaggtaaaagttcattccttgcaccaactgcttcctcttcaaaaccataacaaaatttaaacatcaatttgctagtttcactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2355282 |
attgatgtaacaactttaaggtaaaagttcattccttgcaccaactgcttcctcttcaaaaccataacaaaattcaaacatcaatttgctagtttcactt |
2355381 |
T |
|
| Q |
120 |
catatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctcagccttcagtttttcttcaattctctgct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2355382 |
catatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctcagctttcagtttttcttcaattctctgct |
2355478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 88 - 216
Target Start/End: Complemental strand, 2222689 - 2222561
Alignment:
| Q |
88 |
aaaatttaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctc |
187 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222689 |
aaaattcaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctc |
2222590 |
T |
|
| Q |
188 |
agccttcagtttttcttcaattctctgct |
216 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
2222589 |
agctttcagtttttcttcaattctctgct |
2222561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University