View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3356_high_35 (Length: 223)
Name: NF3356_high_35
Description: NF3356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3356_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 6048565 - 6048355
Alignment:
| Q |
1 |
cattcaactatgggggtttagcttttggtgtacacgtagttttctatatccagcataactttgaatttccctgatattcatagcattgatttgatttagc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6048565 |
cattcaactttgggggtttagcttttggtgtacccgtagttttctatatccagcataactttgaatttccctgatattcatagcattgatttgatttagc |
6048466 |
T |
 |
| Q |
101 |
tgacattggttttagtt-------ggcatgcttattcttagtttcttgtttgcttggctaaggactttaggggctctatgatgtattcattaaggtccag |
193 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6048465 |
tgacattggttttagttggcacttggcatgcttattctttgtttcttgtttgcttggctaaggactttaggggctctatgatgt----attaaggtccag |
6048370 |
T |
 |
| Q |
194 |
gcctcctcctgtttg |
208 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6048369 |
gcctcctcctgtttg |
6048355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University