View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3356_low_15 (Length: 380)
Name: NF3356_low_15
Description: NF3356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3356_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 20 - 370
Target Start/End: Original strand, 44694240 - 44694590
Alignment:
| Q |
20 |
aacgacgcctttaccgcggagaatgcagacagagctgtgaaagaaggagatggacaaaatgggaactgggttttcaaggtttttgatcttaattctgttt |
119 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694240 |
aacgacgccttcaccgcggagaatgcagacagaactgtgaaagaaggagatggacaaaatgggaactgggttttcaaggtttttgatcttaattctgttt |
44694339 |
T |
|
| Q |
120 |
ggaaaggtgaacaagagagtggtgataacgacgaagatgaatgtgatgtttgtagagttgatgaagaggtagacgatgaaaatgaagatgaagagattcg |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694340 |
ggaaaggggaacaagagagtggtgataacgacggagatgaatgtgatgtttgtagagttgatgaagaggtagacgatgaaaatgaagatgaagagattcg |
44694439 |
T |
|
| Q |
220 |
gtttgatagagagtcgttttctagaatgcttcgtagggtaactttagttgaagcaagaatgtatgcacacatgtctcacttggggaatttggcatactct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694440 |
gtttgatagagagtcgttttctagaatgcttcgtagggtaactttagttgaagcaagaatgtatgcacacatgtctcacttggggaatttggcatactct |
44694539 |
T |
|
| Q |
320 |
attcccaatatcaaggtttatttcatcattaatttccttttatgctttcat |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694540 |
attcccaatatcaaggtttatttcatcattaatttccttttatgctttcat |
44694590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University