View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3356_low_26 (Length: 262)
Name: NF3356_low_26
Description: NF3356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3356_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 84 - 242
Target Start/End: Complemental strand, 3245664 - 3245506
Alignment:
| Q |
84 |
gatttctagaaaggttacaaggttatgtttttatgaatgattctatgaaaaaattgtggtttaaagagattctaaccttatttcatttactaatttttta |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3245664 |
gatttctagaaaggttacaaggttatgtttttatgaatgattctatgaaaaaattgtggtttaaagagattctaaccttacttcatttactaatttttta |
3245565 |
T |
 |
| Q |
184 |
ggtgcaaaaatgcatacatgataggtctatccttgttgcaacatatgatggagagcaca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245564 |
ggtgcaaaaatgcatacatgataggtctatccttgttgcaacatatgatggagagcaca |
3245506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University