View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3356_low_27 (Length: 262)
Name: NF3356_low_27
Description: NF3356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3356_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 19396381 - 19396632
Alignment:
| Q |
1 |
ttacacatttttccttgtattctgagtggctgcacaacattgtcacaagcctcgagtatttatcaacacgctcgggttctggcggtgcgttttgaactgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396381 |
ttacacatttttccttgtattctgagtggctgcacaacattgtcacaagcctcgagtatttatcaacacgctcgggttctggcggtgcgttttgaactgg |
19396480 |
T |
 |
| Q |
101 |
tttcttatcattattattatgatctggtcctgatcttttgacaatgacaaatgttacagctgctataacacatgctatgagaacaacagaagttacaccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396481 |
tttcttatcattattattatgatctggtcctgatcttttgacaatgacaaatgttacagctgctataacacatgctatgagaacaacagaagttacaccg |
19396580 |
T |
 |
| Q |
201 |
atcaaaatctttttcttaaggtgttgtttcgcattggcttttcgcctctctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19396581 |
atcaaaatctttttcttaaggtgttgtttcgcattggcttttcgcctttctg |
19396632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University