View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3356_low_31 (Length: 250)
Name: NF3356_low_31
Description: NF3356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3356_low_31 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 21782521 - 21782472
Alignment:
| Q |
201 |
tgaatttctatccatcaaaactatgttattgtaagtttataacaacgaat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
21782521 |
tgaatttctatccatcaaaactatgttattgtacgtttataataacgaat |
21782472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University