View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3356_low_9 (Length: 479)
Name: NF3356_low_9
Description: NF3356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3356_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 261 - 463
Target Start/End: Complemental strand, 25788887 - 25788685
Alignment:
| Q |
261 |
gtccaaacggacagcatatttcgtgaaagtaggaatttttccaacaagtttattggaatgaaggtcaaggctatatagattggaattgagatcatcaaag |
360 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25788887 |
gtccaaatggacagcatatttcatgaaagtaggaatttttccaacaagtttattggaatgaaggtcaaggctatatagattggaattgagatcatcaaag |
25788788 |
T |
 |
| Q |
361 |
ggtctttccaaatttgagatgaaattattggaaagattcagataaaccagatagtcgaatctcaatatccagattggtattgctccatgaatgtagttgt |
460 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25788787 |
ggtctttccaaatctgtgatgaaattattggaaagattcagataaaccagatagttgaatctcaatatccagtttggtattgctccatgaatgtagttgt |
25788688 |
T |
 |
| Q |
461 |
tgg |
463 |
Q |
| |
|
||| |
|
|
| T |
25788687 |
tgg |
25788685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 25788965 - 25788892
Alignment:
| Q |
15 |
aacctgtgagcttgtttccagcaagatttagtactctgagtgtactattcctttttgtcaaacacttgggaata |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
25788965 |
aacctgtgagcttgtttccagcaagatttagtactctgagtgtactattcctttttattaaacacttggaaata |
25788892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University