View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3358_high_1 (Length: 250)
Name: NF3358_high_1
Description: NF3358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3358_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 48483354 - 48483593
Alignment:
| Q |
1 |
ccggaaccaagcgcatgttacatgaacccacagcaactcaacatcagttggcttcagtgcaccacctgcaaagagtttccccatattataaaaacaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48483354 |
ccggaaccaagcgcatgttacatgaacccacagcaactcaacatcagttggcttcagtgcaccacctgcaaagagtttccccatattataaaaacaactt |
48483453 |
T |
|
| Q |
101 |
agcaatggataaacaaatacaaccgcagcataaaaattaaaaggggaaaggggccatttaaatggtaagttgacaatgctaggacttcaaacatatgcca |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48483454 |
agcaatggataaaaaaatacaaccgcagcataaaaattaaaaggggaaaggggccatttaaatggtaagttgacaatgctaggacttcaaacataagcca |
48483553 |
T |
|
| Q |
201 |
aaggaaacttatgaacacatcataaatttataagttcatc |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483554 |
aaggcaacttatgaacacatcataaatttataagttcatc |
48483593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 10036830 - 10036763
Alignment:
| Q |
5 |
aaccaagcgcatgttacatgaacccacagcaactcaacatcagttggcttcagtgcaccacctgcaaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10036830 |
aaccaagcgcatgttacatgaacccacaacatctcgacatcagttggcttcagagcaccacctgcaaa |
10036763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University