View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3358_low_5 (Length: 239)
Name: NF3358_low_5
Description: NF3358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3358_low_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 9053487 - 9053267
Alignment:
| Q |
19 |
attcctccaatagaaataaggtttttcttataaggtaatatatgactaaaatgctctccttcaatgcaaagctcttctatcatctgggattgtaaatcat |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9053487 |
attcctccaatagaaagaaggtttttcttataaggtaatatatgactaaaatgctctccttcaatgcaaagctcttctatcatctgggattgtaaatcat |
9053388 |
T |
 |
| Q |
119 |
acaaaacaatttcattgtctttggtcctgaaaaatacaaaaccattcttccatgttccgataggaataggatgctcgatggaagaaaatggtccaatact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9053387 |
acaaaacaatttcattgtctttggtcctgaaaaatacaaaaccattcttccatgttccgataggaataggatgctcgatgcaagaaaatggtccaatact |
9053288 |
T |
 |
| Q |
219 |
atatagtttagtccatgattc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9053287 |
atatagtttagtccatgattc |
9053267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University