View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3358_low_6 (Length: 238)
Name: NF3358_low_6
Description: NF3358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3358_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 5375680 - 5375467
Alignment:
| Q |
19 |
ggtccaaccggctaaaatgtttacacctggagctattaaatccggtttgagaatctttggtgttaaactatttggtcctcttgaactgaatgctgctacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375680 |
ggtccaaccggctaaaatgtttacacctggagctattaaatccggtttgagaatctttggtgttaaactatttggtcctcttgaactgaatgctgctacc |
5375581 |
T |
 |
| Q |
119 |
actggtgaaggttgaacttgtaagtgtgtgcccccaaaaacaagtttagctcttggatttttcgtagtaaaaacgtagtcttttaaaacagtgcttgatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375580 |
actggtgaaggttgaacttgtaagtgtgtgcccccaaaaacaagtttagctcttggatttttcgtagtaaaaacgtagtcttttaaaacagtgcttgatt |
5375481 |
T |
 |
| Q |
219 |
tttgaccctatgct |
232 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
5375480 |
tttgacccaatgct |
5375467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 135
Target Start/End: Original strand, 47366904 - 47367010
Alignment:
| Q |
29 |
gctaaaatgtttacacctggagctattaaatccggtttgagaatctttggtgttaaactatttggtcctcttgaactgaatgctgctaccactggtgaag |
128 |
Q |
| |
|
|||| |||||| || ||||||||||| | || |||||||| || |||||||| | ||||||||||||| || ||||| ||||| |||||||| || | |
|
|
| T |
47366904 |
gctagaatgttgactcctggagctatcaggtcgggtttgagtatttttggtgtgagtatatttggtcctctagagctgaaagctgccaccactggggatg |
47367003 |
T |
 |
| Q |
129 |
gttgaac |
135 |
Q |
| |
|
||||||| |
|
|
| T |
47367004 |
gttgaac |
47367010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University