View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3359_low_6 (Length: 271)
Name: NF3359_low_6
Description: NF3359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3359_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 32553013 - 32552768
Alignment:
| Q |
9 |
acgttggagctgtattggttggtatggtaagattatggtatacttttctaagcatttgggcaaagtattaaaaactacgttgccatcacatttatttgcg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32553013 |
acgttggagctgtattggttggtatggtaagattatggtatacttttctaagcatttgggcaaagtattaaaaactgcgttgccatcacatttatttgcg |
32552914 |
T |
|
| Q |
109 |
aaaatactttttattttcatgaagagggtcttggattaactagagnnnnnnnctgaggtagaatctttggcatcaannnnnnnnnnnnaagttcagaatc |
208 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32552913 |
aaaatactttttattttcatgaagaaggtcttggattaactagagaaaaaaactgaggtagaatctttggcatcattttttttttttgaagttcagaatc |
32552814 |
T |
|
| Q |
209 |
tttggcatcattagggtggagatagaagatctttggcatcattaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32552813 |
tttggcatcattagggtggagatagaagatctttggcatcattaat |
32552768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University