View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3361_high_18 (Length: 244)
Name: NF3361_high_18
Description: NF3361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3361_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 10214353 - 10214132
Alignment:
| Q |
5 |
agtttttctgttattaagcgatgtgggactaacttcatgccttttgttgtaactctccctttggggtttagacataaaatgcttttaaatcttgcaatct |
104 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10214353 |
agtttttctgttattaagctatgtgggactaacttcatgccttttgttgcaactctccctttggggtttagacataaaatgcttttaaatcttgcaatct |
10214254 |
T |
 |
| Q |
105 |
ttcaagattatgtagctaaacaaaagcagctctggtggggataccgcttcaagtagctggggtctattttcagcttttcatgattggtaagattttacag |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| || |
|
|
| T |
10214253 |
ttcaagattatgtagataaacaaaagcagctctggtggggataccgcttcaagtagctggggcccattttcagcttttcatgattggtaagattttaaag |
10214154 |
T |
 |
| Q |
205 |
ctgaaattttaaatgtgtttga |
226 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
10214153 |
ctgagattttaaatgtgtttga |
10214132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 10101193 - 10101405
Alignment:
| Q |
5 |
agtttttctgttattaagcgatgtgggactaacttcatgccttttgttgtaactctccctttggggtttagacataaaatgcttttaaatcttgcaatct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||| |||||| ||||||||||||||| | ||||||||| |
|
|
| T |
10101193 |
agtttttctgttattaagcgatgtgggactaacttcgttgtttttgttgtaactctcgctttgggttttagatataaaatgcttttaagttttgcaatct |
10101292 |
T |
 |
| Q |
105 |
ttcaagattatgtagctaaacaaaagcagctctggtggggataccgcttcaagtagctggggtctattttcagcttttcatgattggtaagattttacag |
204 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||| ||||| |||||| | |||||| | | ||||||||| |||||||||||||||| |
|
|
| T |
10101293 |
ttcaagattctgtagcaaaacaaaagcagctttggtggggctaccgtttcaagaatctggggccca--------ttttcatgaatggtaagattttacag |
10101384 |
T |
 |
| Q |
205 |
ctgaaattttaaatgtgtttg |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10101385 |
ctgaaattttaaatgtgtttg |
10101405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 103 - 201
Target Start/End: Complemental strand, 9678576 - 9678478
Alignment:
| Q |
103 |
ctttcaagattatgtagctaaacaaaagcagctctggtggggataccgcttcaagtagctggggtctattttcagcttttcatgattggtaagatttta |
201 |
Q |
| |
|
||||||||||| |||| | |||||||||||| |||||| | | ||||| |||||| |||| ||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
9678576 |
ctttcaagattctgtaacaaaacaaaagcagttctggtcgtgctaccgtttcaagaagcttgggcctattttcagcttttcatgattgataagatttta |
9678478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 36
Target Start/End: Original strand, 10104996 - 10105027
Alignment:
| Q |
5 |
agtttttctgttattaagcgatgtgggactaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10104996 |
agtttttctgttattaagcgatgtgggactaa |
10105027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University