View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3361_high_20 (Length: 214)
Name: NF3361_high_20
Description: NF3361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3361_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 44548237 - 44548406
Alignment:
| Q |
1 |
actcagcctcaagagcttggaaggggaaagaggtataagaaggctaacacaagatatactcaatgagggtgtttaaggaagcttggcacatagtaggatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44548237 |
actcagcctcaagagcttggaaggggaaagaggtataagaaggctaacacaagatatactcaatgagggtgtttaaggaaggttggcacatagtaggatg |
44548336 |
T |
|
| Q |
101 |
aggcattcaatgacaacatatcaatcctctcttttggaatctcggcttgcttttctccttactttcttat |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44548337 |
aggcattcaatgacaacatatcaatcctctcttttggaatctcggcttgcttttctcattactttcttat |
44548406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University